Everything below concerns lyophilized powder. We keep the language plain, cite what the science says, and separate well-supported claims from open questions.
Last reviewed on 2026-04-12. Where a claim depends on a specific study, the study is described rather than over-claimed.
In its supplied form epitalon is a white to off-white powder, usually lyophilized and often hygroscopic. It dissolves readily in water and in aqueous buffers, and it is commonly handled as the acetate or trifluoroacetate salt to improve stability during purification and drying. The amide backbone is labile in aqueous media, so solutions are less durable than the dry solid. Handling notes in the chemical literature therefore emphasize keeping the powder dry, cool and shielded from light until it is dissolved.
Epitalon is a synthetic tetrapeptide whose sequence is alanine-glutamate-aspartate-glycine, written in single-letter code as AEDG. The four residues are joined by three peptide bonds, giving a linear backbone with no branching and no disulfide bridges. Its calculated molecular mass for the free form is approximately 390.3 daltons, a figure that rises when the compound is supplied as an acetate or trifluoroacetate salt. Because the chain is short, the molecule is defined entirely by its residue order rather than by any folded three-dimensional structure.
Epitalon appears in the literature primarily through a small number of research groups, most of them associated with the St. Petersburg Institute of Bioregulation and Gerontology. Publications describe cell culture experiments, animal studies, and a limited number of small human studies. Independent replication outside this network is sparse. As a result, reviews of the topic usually separate descriptive reports of observed effects from the question of whether those effects generalize, and they note the difficulty of comparing studies that use different preparations and endpoints.
Analytical characterization of epitalon relies on standard peptide methods. Reverse-phase high-performance liquid chromatography is used to assess purity, and mass spectrometry confirms identity by checking the observed mass against the expected value near 390 daltons. Amino acid analysis can verify composition. Because the peptide is short and hydrophilic, it elutes early on many reverse-phase columns, so method development often requires ion-pairing reagents to achieve adequate retention and resolution from related impurities.
| Property | Value | Notes |
|---|---|---|
| Chemical class | Synthetic tetrapeptide | Four residues, linear chain |
| Residue sequence | Ala-Glu-Asp-Gly | Single-letter form AEDG |
| Calculated mass | 390.3 daltons | Value for the free, uncharged form |
| Appearance | White to off-white powder | Usually supplied lyophilized |
| Solubility | Freely soluble in water | Often handled as a salt form |
Laboratory-grade epitalon is typically supplied as a lyophilized powder. Purity is commonly assessed with reverse-phase high-performance liquid chromatography, often paired with mass spectrometry to confirm molecular identity. Amino acid analysis and peptide mapping can provide additional confirmation of sequence. Certificates of analysis for research materials frequently report purity above 95 percent, although the methods behind such figures vary between suppliers. The absence of a pharmacopeial monograph means that no single standardized assay defines the compound, so reported results depend on the analytical protocol chosen.
Storage recommendations center on limiting moisture, heat, and light. The dry powder is generally kept at minus 20 degrees Celsius, and some suppliers recommend minus 80 degrees for long-term archival. Once dissolved, solutions are usually aliquoted and frozen to avoid repeated freeze-thaw cycles, which can promote aggregation or degradation. Aqueous stability depends on pH and concentration, and buffered saline is often preferred over plain water for biological work. Stability data specific to epitalon remain limited, so general peptide-handling practices are applied by analogy rather than from product-specific validation.
Epitalon is a synthetic tetrapeptide with the sequence alanine-glutamate-aspartate-glycine, abbreviated AEDG. Its molecular formula is C14H22N4O9 and its calculated monoisotopic mass is approximately 390.35 daltons. The compound does not occur naturally as a free peptide; it is produced by solid-phase peptide synthesis. Because it contains two acidic residues and no basic residues, the neutral form carries a net negative charge at physiological pH. This charge profile influences how the peptide behaves in solution and during chromatographic analysis.
Storage practice centres on limiting moisture, oxygen, and repeated temperature cycling. Freeze-dried powder is generally held desiccated at minus twenty degrees Celsius or colder and protected from light. Reconstituted solutions are markedly less stable, and the aspartate-glycine junction is prone to succinimide formation at neutral to mildly alkaline pH. Portioning material into single-use aliquots reduces degradation compared with repeated freeze-thaw cycles. Stability data specific to this tetrapeptide remain scarce, so most handling guidance is extrapolated from general peptide chemistry rather than measured directly.
Documentation accompanying research peptides usually includes a certificate of analysis listing the batch number, purity figure, and test methods applied. Buyers comparing suppliers should check whether the reported purity refers to chromatographic area or to a mass-balance calculation, because the two are not equivalent. Counter-ion content, residual solvents, and water content are sometimes omitted from such certificates even though they affect the actual peptide mass present. Independent verification through a second laboratory is the most direct way to confirm that a supplied material matches its label.
The compound is generally presented as a synthetic fragment of epithalamin, a pineal gland extract investigated in the former Soviet Union from the 1970s onward. Vladimir Khavinson and colleagues in Saint Petersburg developed short peptides modelled on such extracts, and epitalon became the most widely cited of those sequences. Most primary reports appeared in Russian-language journals or in proceedings with limited international circulation. Independent replication in laboratories outside that network remains sparse, and much repeated secondary material traces back to a small number of originating groups.
Laboratory work has examined effects on telomerase activity in cultured cells, on melatonin rhythms in animals, and on markers of oxidative stress. Some experiments report measurable changes while others show none, and the reported findings rest largely on small studies. The absence of large independent trials means the generality of these results is unresolved rather than settled. Review articles occasionally apply the label geroprotector, a term that reflects a research hypothesis about ageing rather than an established clinical finding.
Laboratory handling begins with dissolution of the lyophilized powder in water or a suitable aqueous buffer. The dry solid is the more stable form, so stock solutions are generally prepared only when required and kept cold afterwards. Repeated freezing and thawing of a solution is avoided because it encourages aggregation and gradual loss of the intact chain. Diluents and containers are selected to limit adsorption of a short peptide onto plastic surfaces and to reduce microbial growth in aqueous preparations.
Stability depends strongly on pH, temperature and the presence of oxygen and trace metals. Cleavage of the backbone proceeds faster under neutral to alkaline conditions, whereas acidic solutions tend to slow that reaction. The aspartate and glutamate side chains can undergo deamidation or imide formation over time, generating closely related impurities. Published stability data specific to epitalon are sparse, so the usable life of a given solution is best regarded as an open question that depends on buffer composition, concentration and storage temperature.
=== Bibliography === Aerei da combattimento della Seconda Guerra Mondiale (in Italian). Novara, Italy: De Agostini Editore, 2005. Anderson, Peter N. Mustangs of the RAAF and RNZAF. Sydney, Australia: A.H. & A.W. Reed Pty Ltd, 1975. ISBN 0-589-07130-0. Angelucci, Enzo and Peter Bowers. The American Fighter: The Definitive Guide to American Fighter Aircraft from 1917 to the Present. New York: Orion Books, 1985. ISBN 0-517-56588-9. Aro, Chuck and Colin Aro. "World's Fastest Mustangs". Air Enthusiast. No. 13, August–November 1980. pp. 56–62. ISSN 0143-5450 Birch, David. Rolls-Royce and the Mustang. Derby, UK: Rolls-Royce Heritage Trust, 1987. ISBN 0-9511710-0-3. Bowen, Ezra. Knights of the Air (Epic of Flight). New York: Time-Life Books, 1980. ISBN 0-8094-3252-8. Borth, Christy. Masters of Mass Production. Indianapolis, Indiana: Bobbs-Merrill Co., 1945. Bowman, Martin W. P-51 Mustang vs Fw 190: Europe 1943–45. Oxford, UK: Osprey Publishing, 2007. ISBN 1-84603-189-3. Boylan, Bernard. Development of the Long Range Escort Fighter. Washington, D.C.: USAF Historical Division, Research Studies Institute, Air University, 1955. Retrieved: 15 July 2014. Boyne, Walter J. Clash of Wings. New York: Simon & Schuster, 1994. ISBN 0-684-83915-6. Breffort, Dominique with André Jouineau. Le North-American P-51 Mustang – de 1940 à 1980 (Avions et Pilotes 5)(in French). Paris: Histoire et Collections, 2003. ISBN 2-913903-80-0. Bridgman, Leonard, ed. "The North American Mustang." Jane's Fighting Aircraft of World War II. London: Studio, 1946. ISBN 1-85170-493-0.
=== Phenol–chloroform extraction === The basic principle of the phenol-chloroform extraction is that DNA and RNA are relatively insoluble in phenol and chloroform, while other cellular components are relatively soluble in these solvents. The addition of a phenol/chloroform mixture will dissolve protein and lipid contaminants, leaving the nucleic acids in the aqueous phase. It also denatures proteins, like DNase, which is especially important if the plasmids are to be used for enzyme digestion. Otherwise, smearing may occur in enzyme restricted form of plasmid DNA.
The united armies of the Holy League expelled the Ottoman troops from Central Europe between 1684 and 1699, and the Principality of Transylvania was integrated into the Habsburg monarchy. The Habsburgs supported the Catholic clergy and persuaded the Orthodox Romanian prelates to accept the union with the Roman Catholic Church in 1699. In the 18th century, Moldavia and Wallachia maintained their internal autonomy, but in 1711 and 1716, respectively, the period of the Phanariots began, with rulers appointed directly by the Porte from among the noble families of Greek origin in Constantinople. With the signing of the Ausgleich in 1867, Transylvania quickly lost its remaining political autonomy, being politically and administratively incorporated into the Kingdom of Hungary. The Church Union strengthened the Romanian intellectuals' devotion to their Roman heritage. The Orthodox Church was restored in Transylvania only after Orthodox monks stirred up revolts in 1744 and 1759. The organisation of the Transylvanian Military Frontier caused further disturbances, especially among the Székelys in 1764. Princes Dimitrie Cantemir of Moldavia and Constantin Brâncoveanu of Wallachia concluded alliances with the Habsburg Monarchy and Russia against the Ottomans, but they were dethroned in 1711 and 1714, respectively. The sultans lost confidence in the native princes and appointed Orthodox merchants from the Phanar district of Istanbul to rule Moldavia and Wallachia. The Phanariot princes pursued oppressive fiscal policies and dissolved the army.
==== Proposed upgrades ==== In April 2012, BAE unveiled a potential version of the system mount, developed in collaboration with Rafael Advanced Defense Systems. It is visually distinctive from previous versions with its stealthy housing, which also protects the gun from weather and allows for easier access to internal components through large access panels. The upgrade mounts a larger Alliant Techsystems Mk44 Bushmaster II 30 mm cannon for a 500-meter range increase, as well as a coaxial .50 caliber M2 heavy machine gun. Elevation is increased to +75 degrees for engaging UAVs and helicopters, and ammunition storage is greater at 420 30 mm rounds. Other features include a larger manual fire control panel, an offset mode specifically for firing warning shots, and a surveillance mode where the gun can be pointed away from a target but the EO sensor remains pointed in the target direction. Although it has a high degree of commonality and has the same footprint as previous models, the upgrade is 20 percent heavier due to the greater ammo load.
=== Role in periodontal tissues === Elaunin fibers in the periodontal ligament (PDL) have connective tissue that anchors each tooth to the surrounding bone and helps cushion the forces we generate while chewing. In studies on rat molars, researchers found that elaunin fibers appear alongside oxytalan and mature elastic fibers. It forms a flexible network that allows the PDL to stretch during function and then return to its original shape (Sawada et al., 2006).
Sources: en.wikipedia.org
=== (2) Separation and quantification methods === Separation methods are the first step to decomplexify the venom sample, with a common method being reverse‐phase high performance liquid chromatography (RP-HPLC). This method can be applied broadly to nearly all venoms as a crude fractionation method and to detect the peptide bonds found. A less common techniques like 1D/2D gel electrophoresis can also be used in cases of venoms containing heavy, complex peptides (Preferable >10KDa). This means in additions to RP-HPLC, Gel electrophoresis can help identify large molecules (such as enzymes) and to help refine venom prior to further analytical methods. Next, N-terminal sequencing is used to find the amino acid order of the fractionated proteins/peptides starting with the N-terminal end. Furthermore, SDS‐PAGE (Sodium dodecyl sulfate-polyacrylamide gel electrophoresis) can be performed on the isolated proteins from the RP-HPLC to identify proteins of interest before moving on to the identification stage.
=== 1918 uprisings === In mid-1918, the Union moved from underground organization to open insurrection. It played a central role in organizing a series of anti-Bolshevik uprisings, most notably in Yaroslavl, but also in Rybinsk, Murom, and Elatma. These uprisings formed part of a broader effort to ignite coordinated resistance against the Bolshevik government. Additional revolts were reportedly planned in Moscow and Kazan, but arrests of members of the organization in May 1918 disrupted these plans before they could be carried out. The uprisings were suppressed by Soviet forces, and the Union's operational structure inside Russia was effectively broken apart in the aftermath.
== Terminology == To both Russians and Poles, the term Russian Poland was not acceptable. To the Russians after partition, Poland ceased to exist, and their newly acquired territories were considered the long lost parts of Mother Russia. To Poles, Poland was simply Polish, never Russian. While the Russians used varying administrative names for their new territories (see below), another popular term, used in Poland and adopted by most other historiographies, was the Russian Partition.
Thionyl chloride is an inorganic compound with the chemical formula SOCl2. It is a moderately volatile, colourless liquid with an unpleasant acrid odour. Thionyl chloride is primarily used as a chlorinating reagent, with approximately 45,000 tonnes (50,000 short tons) per year being produced during the early 1990s, but is occasionally also used as a solvent. It is toxic, reacts with water, and is also listed under the Chemical Weapons Convention as it may be used for the production of chemical weapons. Thionyl chloride is sometimes confused with sulfuryl chloride, SO2Cl2, but the properties of these compounds differ significantly. Sulfuryl chloride is a source of chlorine whereas thionyl chloride is a source of chloride ions.
Sources: en.wikipedia.org
=== Ribosomal RNA modification === Ribosomal RNA (rRNA) is essential to the makeup of ribosomes and peptide transfer during translation processes. Ribosomal RNA modifications are made throughout ribosome synthesis, and often occur during and/or after translation. Modifications primarily play a role in the structure of the rRNA in order to protect translational efficiency. Chemical modification in rRNA consists of methylation of ribose sugars, isomerization of uridines, and methylation and acetylation of individual bases.
CTCCAACATCAAGGAAGATGGCATTTCTAG (sequence source: US FDA ETEPLIRSEN BRIEFING DOCUMENT NDA 206488), 30-mer, 20% G, 43% CG, Predicted Tm: 88.9 °C at 10 μM oligo. Oligo complement CTAGAAATGCCATCTTCCTTGATGTTGGAG DMD-001 Exon 51, ENST00000357033.8 in Ensembl.org, RNA target site marked. Given that the target site is within an exon, this is likely blocking binding of an exonic splice enhancer protein and so altering splicing by interfering with splice regulation. CTCCTACTCAGACTGTTACTCTGGTGACACAACCTGTGGTTACTAAGGAAACTGCCATCT CCAAA[CTAGAAATGCCATCTTCCTTGATGTTGGAG]GTACCTGCTCTGGCAGATTTCAACC GGGCTTGGACAGAACTTACCGACTGGCTTTCTCTGCTTGATCAAGTTATAAAATCACAGA GGGTGATGGTGGGTGACCTTGAGGATATCAACGAGATGATCATCAAGCAGAAG
== Research == Wadden’s research has focused on the behavioral and medical management of obesity. His early work on very low-calorie diets (VLCDs) included the first long-term trial of high-protein VLCDs, showing short-term efficacy but frequent weight regain, which underscored the need for long-term maintenance strategies. In the 1990s, he helped establish methods for evaluating commercial weight-loss programs, contributing to federal consumer-protection efforts. Beginning in the late 1990s, Wadden’s trials demonstrated that combining weight-loss medications with intensive lifestyle intervention (ILI) produced greater weight reduction than either approach alone, shaping clinical guidelines and drug trial designs. He also played a central role in research that supports the Centers for Medicare and Medicaid Services reimbursement of intensive behavioral therapy (IBT) for obesity. His studies showed that brief, protocol-driven IBT sessions delivered in primary care produced clinically meaningful weight loss. As a principal investigator on the NIH-funded Look AHEAD trial, Wadden helped show that ILI improved cardiometabolic risk factors, physical function, quality of life, and health-care costs in patients with type 2 diabetes, despite not reducing cardiovascular events. More recently, he has reported on glucagon-like peptide-1 (GLP-1) medications such as semaglutide and tirzepatide, which produce substantial weight loss and health benefits.
Fast protein liquid chromatography (FPLC) is a form of liquid chromatography that is often used to analyze or purify mixtures of proteins. As in other forms of chromatography, separation is possible because the different components of a mixture have different affinities for two materials, a moving fluid (the mobile phase) and a porous solid (the stationary phase). In FPLC the mobile phase is an aqueous buffer solution. The buffer flow rate is controlled by a positive-displacement pump and is normally kept constant, while the composition of the buffer can be varied by drawing fluids in different proportions from two or more external reservoirs. The stationary phase is a resin composed of beads, usually of cross-linked agarose, packed into a cylindrical glass or plastic column. FPLC resins are available in a wide range of bead sizes and surface ligands depending on the application. FPLC was developed and marketed in Sweden by Pharmacia in 1982, and was originally called fast performance liquid chromatography to contrast it with high-performance liquid chromatography (HPLC). FPLC is generally applied only to proteins; however, because of the wide choice of resins and buffers it has broad applications. In contrast to HPLC, the buffer pressure used is relatively low, typically less than 5 bar, but the flow rate is relatively high, typically 1–5 ml/min. FPLC can be readily scaled from analysis of milligrams of mixtures in columns with a total volume of 5 ml or less to industrial production of kilograms of purified protein in columns with volumes of many liters.
If a protein was introduced that increased the integrity of its parent bubble, then that bubble had an advantage. Primitive reproduction may have occurred when the bubbles burst, releasing the results of the experiment into the surrounding medium. Once enough of the right compounds were released into the medium, the development of the first prokaryotes, eukaryotes, and multi-cellular organisms could be achieved. However, the first cell membrane could not have been composed of phospholipids due its low permeability, as ions would not able to pass through the membrane. Rather it is suggested they were composed of fatty acids, as they can freely exchange ions, allowing geochemically sustained proton gradients at alkaline hydrothermal vents that might lead to prebiotic chemical reactions via CO2 fixation.
Sources: en.wikipedia.org
The peptide contains four residues in the order alanine, glutamate, aspartate and glycine, abbreviated AEDG. The chain is linear and held together by three peptide bonds. Its calculated mass for the uncharged free form is about 390.3 daltons.
Epithalamin refers to a crude preparation derived from bovine pineal tissue, which contains many components. Epitalon is a single synthetic tetrapeptide identified from that material and produced by chemical synthesis. The two names are sometimes confused because early reports treated the synthetic peptide as an active fragment of the extract.
It has been registered for clinical use in Russia, where it is associated with a small family of short peptides. In most other jurisdictions it is not an approved medicine and is traded as a research chemical. Regulatory status varies by country and changes over time.
Identity is normally confirmed by mass spectrometry, which checks the measured mass against the expected value near 390 daltons. Reverse-phase high-performance liquid chromatography is used alongside it to assess purity. Amino acid analysis can provide additional composition data.